ACP Vector


Identification of psyllid attractants and development of highly effective trapping and attract-and-kill methods for improved psyllid control

Report Date: 06/26/2009   Project: 72622

Identification of psyllid attractants and development of highly effective trapping and attract-and-kill methods for improved psyllid control

Report Date: 06/26/2009
Project: 72622
Category: ACP Vector

The purpose of this proposal is to identify and develop attractants, both pheromone and host-plant based, for the Asian citrus psyllid (ACP). The intent is to develop a highly effective attract-and-kill control system for ACP with such attractants, as well as to develop highly effective monitoring traps to effectively evaluate ACP population densities to better determine the need for spraying. Thus far, in collaboration with USDA colleagues, we have determined that virgin and mated male ACP colonized citrus plants that were currently or had been previously colonized by virgin or mated female ACP in greater numbers than control plants without females. However, males or females did not accumulate more on plants colonized by conspecifics of the same sex compared with uninfested plants and females showed no preference for plants pre-infested with males compared with uninfested controls. In complementary Y-tube behavioral assays in the laboratory, virgin and mated males chose arms with odor sources from mated females compared with blank controls in the absence of associated citrus host plant volatiles. In both behavioral assays mated female ACP appeared more attractive compared with virgin females. Collectively, our results provide behavioral evidence for a female-produced volatile sex attractant pheromone in ACP. Subsequently, we determined that male ACP, irrespective of abdominal color, exhibited stronger evidence of attraction to crushed blue/green females than to crushed gray/brown females. Gray/brown individuals of both sexes showed an increase in body mass 5Ð6 d after transfer to a new citrus seedling, suggesting that abdominal color (which is closely related to body mass) may be influenced at least in part by plant quality. Next, we examined the behavioral responses of mated and unmated ACP of both sexes to odors from host plants in laboratory tests, with and without visual cues in collaboration with USDA colleagues. The host plants tested were: ÔDuncanÕ grapefruit, sour orange, ÔNavelÕ orange, and Murraya paniculata. Responses varied by plant species and by psyllid sex and mating status. Generally, evidence of attraction was stronger in females and in mated individuals of both sexes relative to virgins. The presence of a visual cue typically enhanced attractiveness of olfactory cues; in no case did unmated individuals show evidence of attraction to host plant odors in the absence of a visual cue. Antennal responses to citrus volatiles were confirmed by electroantennogram. The results suggest that ACP uses olfactory and visual cues in orientation to host plants, and suggest the possibility of using plant volatiles in monitoring and management of this pest. Subsequently, we analyzed the chemicals produced by psyllids using gas chromatography and mass spectrometry. We discovered a total of 85 compounds including 8 male and 13 female ACP-specific volatile chemicals with both sexes having 40 volatile compounds in common. Interestingly, we discovered that both ACP and its parasitoid produce .-Butyrolactone. In behavioral assays in the laboratory, we found that .-Butyrolactone is attractive to male ACP, but not to females suggesting that this chemical may be part of the female ACP pheromone blend. In collaboration with an industry partner, (Alpha Scents, West Linn, OR), we obtained custom-made release devices for .-Butyrolactone as well as dispenser for synthetic plant volatiles identified and developed by a USDA collaborator. In our initial field tests, results with .-Butyrolactone have been inconclusive. Although in one trial it appeared that this chemical incleased catch of ACP on traps, the results were inconsistent in follow up trials. However, simultaneously releasing .-Butyrolactone and synthetic citrus volatiles did increase catch of ACP on traps compared to unbaited traps. We continue testing the chemicals that have been identified thus far in field trapping tests in an effort to optimize release rates and blends. Also, work is ongoing on identification of further possible attractants with chemical and behavioral testing of ACP.



Development and optimization of biorational tactics for Asian citrus psyllid control and decreasing huanglongbing incidence.

Report Date: 06/25/2009   Project: 72360

Development and optimization of biorational tactics for Asian citrus psyllid control and decreasing huanglongbing incidence.

Report Date: 06/25/2009
Project: 72360
Category: ACP Vector

The purpose of this investigation is to develop, evaluate, and optimize biorational management tools for Asian citrus psyllid (ACP) including insect growth regulators and antifeedants. In our first set of laboratory studies with insect growth regulators, we investigated the activity of pyriproxyfen, a juvenile hormone mimic, on ACP eggs, nymphs and adults to evaluate its potential usefulness as a biorational insecticide for inclusion into an integrated pest management (IPM) strategy for ACP control. Pyriproxyfen exhibited strong ovicidal and larvicidal activity against ACP eggs and nymphs, respectively, in age- and concentration-dependent manners. Irrespective of egg age and timing of treatment, a significantly lower percentage of eggs (5-29%) hatched into nymphs at the higher concentrations tested (64 and 128 µg mL-1). A significantly lower percentage of early instar nymphs (first, second and third) survived and emerged into adults (0-36%) at the three higher concentrations tested (16, 32, and 64 µg mL-1) compared with late instar nymphs (fourth and fifth) (25-74%). However, 15-20% of those adults that emerged from late instar nymphs exhibited morphological abnormalities. Furthermore, pyriproxyfen exhibited transovarial activity by significantly reducing the fecundity of females and viability of eggs deposited by females that emerged from treated fifth instar nymphs. Topical application of pyriproxyfen to adults at 100 µg mL-1 also significantly reduced fecundity and egg viability. Application of pyriproxyfen at 64 µg mL-1 results in the highest inhibition of egg hatch in younger eggs (0-48 h old) laid before or after treatment and strongest suppression of adult emergence from early instar nymphs compared with other rates tested. Pyriproxyfen also markedly reduced female fecundity and egg viability for adults that were exposed either directly or indirectly. The direct (ovicidal and larvicidal) and indirect (transovarial) effects of pyriproxyfen against immature and adult ACP, respectively, suggest that integration of this insecticide as part of an IPM strategy should negatively impact ACP populations over time. Future studies are needed to determine the effects of field aged residues. Also, further field scale testing is needed to determine how to best incorporate pyriproxyfen into an integrated management program for ACP. We are now moving onto detailed investigations of other insect growth regulators including buprofezin, and diflubenzuron. In a separate investigation, we have been studying the sub-lethal effects of various insecticides. Given the broad use of imidacloprid for management of ACP, particularly on young trees, we investigated it’s possible sub-lethal effects first. Because of the variation in spatial and temporal uptake and systemic distribution of imidacloprid applied to citrus trees and its degradation over time in citrus trees, ACP adults and nymphs are exposed to concentrations that may not cause immediate mortality but rather sublethal effects. The objective of this laboratory study was to determine the effects of sublethal concentrations of imidacloprid on ACP life stages. Feeding by ACP adults and nymphs on plants treated daily with a sublethal concentration (0.1 µg mL-1) of imidacloprid significantly decreased adult longevity (8 d), fecundity (33%), and fertility (6%) as well as nymph survival (12%) and developmental rate compared with untreated controls. The magnitude of these negative effects was directly related to exposure duration and concentration. Furthermore, ACP adults that fed on citrus leaves treated systemically with lethal and sublethal concentrations of imidacloprid excreted significantly less honeydew (7-94%) compared with controls in a concentration-dependent manner suggesting antifeedant activity of imidacloprid. Sublethal concentrations of imidacloprid negatively affect development, reproduction, survival, and longevity of ACP which likely contributes to population reductions over time. Also, reduced feeding by ACP adults on plants treated with sublethal concentrations of imidacloprid may potentially decrease the capacity of ACP to successfully acquire and transmit the HLB causal pathogen. Ongoing investigations include the effects of feeding inhibitors on HLB transmission.



Development of attractants for Tamarixia radiata, a parasitoid of Asian citrus psyllid (ACP), for improved biological control of ACP

Report Date: 06/25/2009   Project: 73059

Development of attractants for Tamarixia radiata, a parasitoid of Asian citrus psyllid (ACP), for improved biological control of ACP

Report Date: 06/25/2009
Project: 73059
Category: ACP Vector

The main objective of this series of investigations has been to develop an effective attractant for Tamarixia radiata, the main parasitic wasp attacking Asian citrus psyllid (ACP) in Florida. Development of an effective attractant for this insect will allow for accurate monitoring of this beneficial insect and it will allow us to recruit and establish high populations of this beneficial insect to improve biological control of ACP. The first goal of this proposal was to conduct an in depth morphological investigation of the antenna sensilla of this wasp parasitoid, including functional morphological studies, which would reveal the functional details of the discovered sensilla. As originally proposed, transmission electron microscopy (TEM) studies of T. radiataÕs antennal sensilla were required to guide further electrophysiological investigations of this ACP parasitoid, which would allow identification of chemical attractants. This first objective has been completed and the investigation has been published in a peer-reviewed scientific journal (Onagbola, E.O., D.R. Boina, S.L. Herman, and L.L. Stelinski. 2009. Antennal sensilla of Tamarixia radiata (Hymenoptera: Eulophidae), a parasitoid of Diaphorina citri (Hemiptera: Psyllidae). Annals of the Entomological Society of America. 102: 523-531). Specifically, we examined the external and functional morphology of the antennal sensilla of adult male and female T. radiata using scanning (SEM) and transmission (TEM) electron microscopy, respectively, to gain insights into the behavioral ecology of this parasitoid. The antennae of male and female T. radiata were composed of a long scapula-shaped scape with a basal radicula, a barrel-shaped pedicel and a long flagellum with a basal ring-like annulus. Five morphologically distinct sensilla including two aporous sensilla trichoidea (AST-1 and AST-2), one multiporous sensilla trichoidea (MST), one multiporous placoid sensilla (MPS), and one aporous basiconic capitate peg sensilla (BCPS) were identified on the antennae of both sexes. Male antennae consisted of four funicular flagellomeres and possessed a greater number of olfactory MST than female antennae suggesting their possible function in perception of mate-related volatile cues. Female antennae were characterized by three funicular flagellomeres and a greater number of MPS than male antennae suggesting their possible function in the perception of host-related volatile cues. Thus male antennae likely function to detect female-produced pheromones, while female antennae function to detect host volatiles used in finding ACP for parasitization. Next, we moved onto conducting an in depth analysis of the chemicals produced by both sexes of this parasitoid. We discovered that both male and female ACP parasitoids release several volatile compounds. Our analyses revealed Propa-2-one, 1-Butanol and 4,6,8-Trimethyl nonene as female parasitoid-specific volatiles; Dodecane, 4,6-dimethyl, Acetc acid, .-Butyrolactone, and Diphenylamine as male specific volatiles while Decanal and 3-Methyl diphenylalamine were produced by both sexes. In laboratory behavioral tests, we found that male parasitoids were attracted to .-Butyrolactone to the same degree as to female parasitoids, indicating that this is likely the sex-attractant pheromones females produce and release to attract males. Electrophysiological recordings from male parasitoid antennae confirmed that males are capable of detecting this chemical. Subsequently, we set out to develop a dispenser for releasing this chemical in the field for both monitoring of parasitoid populations and for recruiting parasitoids into groves to increase their population densities and improve biological control of ACP. We partnered with an industry collaborator (Alpha Scents, West Linn, OR) to develop an appropriate dispenser for releasing .-Butyrolactone. We have developed a polyethylene-tube dispenser for releasing this chemical. We also obtained a second chemical (Methyl Salicylate) and associated dispenser from a second collaborator (AgBio, Corporation). This chemical is known to recruit beneficial insects and improve biological control. We are currently field testing both products to determine whether we can improve biological control of ACP.



Development of Effective Guava-based Repellent to Control Asian Citrus Psyllid and Mitigate Huanglongbing Disease Incidence

Report Date: 06/25/2009   Project: 72614

Development of Effective Guava-based Repellent to Control Asian Citrus Psyllid and Mitigate Huanglongbing Disease Incidence

Report Date: 06/25/2009
Project: 72614
Category: ACP Vector

Over the past year, we have been working to develop an effective repellent for the Asian citrus psyllid (ACP). Our work was initiated by investigating the volatiles released by guava plants and their effects on ACP behavior. Initially, we found that dimethyl disulfide (DMDS) was produced in large quantities by wounded guava leaves. This prompted an investigation of the effects of this chemical on ACP behavior. DMDS is a known plant defense chemical against insects and we have shown that it acts as both a repellent and a neurotoxin against psyllids. We quantified the airborne concentration of DMDS that induced the behavioral effect in the laboratory behavioral tests and found it to be 107pg/cc. Compounds similar to DMDS including dipropyl disulfide, ethyl-1-propyl disulfide, and ethyl disulfide did not affect the behavioral response of ACP to attractive citrus host plant volatiles in laboratory behavioral tests. These data suggested that the activity of DMDS on the behavior of ACP is somewhat unique and not shared by all disulfide compounds. However, more recently we have found that certain other sulfur compounds, including dimethyl trisulfide and allyl methyl disulside, are either slightly more or equally active against the psyllid than the originally identified DMDS. Determining whether a blend of these chemicals will increase the repellent effect further is currently under investigation. Field trials were conducted this past spring and summer to test the effect of synthetic DMDS released from polyethylene vials and other devices on population densities of ACP. The treatments compared were plots treated with DMDS versus untreated control plots. In one trial, fifteen ml of synthetic DMDS was formulated per polyethylene vial and approximately 200 vials were deployed per acre. This release device was developed with one of our industry partners (Alpha Scents). In this initial field experiment, populations of ACP were significantly reduced by deployment of synthetic DMDS from the polyethylene vials compared with untreated control plots. This small plot field experiment confirmed the results of our laboratory olfactometer assays. Deployment of synthetic DMDS from polyethylene vials reduced populations of ACP in an unsprayed citrus grove for up to 3 weeks following deployment. Given that population densities were equivalent among plots prior to the deployment of DMDS treatments, we hypothesize that DMDS repelled adult ACP from treated plots. By the fourth week, there was no remaining DMDS in the polyethylene vials, which likely explains why populations were once again equivalent in treated and control plots by the fourth week of the trial. Given the volatility of DMDS, one of the main obstacles to the development of a practical DMDS formulation for ACP management will be development of a slow-release device that maintains the chemical above a behaviorally active threshold for long periods. Ideally, a slow-release device should be developed that could achieve 150-200 days of behaviorally efficacious release. We are working with ISCA Technologies (Riverside, CA) to develop a flowable formulation of the psyllid repellent that also shows considerable promise. Our initial work with this formulation shows that it works, but also for only 3-4 weeks. Also, this formulation does not reduce psyllid populations as effectilly as currently available pesticides. Although DMDS appears to be a potential candidate repellent for ACP, other repellent compounds similar to DMDS have been recently discovered and they are being investigated further to detemine if a more potent blend can be developed. Our current on-going efforts include formulating these repellent chemicals into controlled release devices for extended release of the chemical in the field. We have also begun a corroborative project with engineers from Auburn University to develop an effective release device for DMDS and related sulfur chemicals. Our goal is to develop a product that would be effective for several months.



Development of Effective Guava-based Repellent to Control Asian Citrus Psyllid and Mitigate Huanglongbing Disease Incidence

Report Date: 06/25/2009   Project: 72614

Development of Effective Guava-based Repellent to Control Asian Citrus Psyllid and Mitigate Huanglongbing Disease Incidence

Report Date: 06/25/2009
Project: 72614
Category: ACP Vector

The purpose of this project has been to develop an effective repellent for the Asian citrus psyllid (ACP). Our work was initiated by investigating the volatiles released by guava plants and their effects on ACP behavior. Following the discovery that synthetic dimethyl disulfide (DMDS) was produced in large quantities by wounded guava leaves, we initiated an investigation of the effects of this chemical on ACP behavior. DMDS is a known plant defense chemical against insects that acts as both a repellent and a neurotoxin. In laboratory tests, we have confirmed that volatiles from guava leaves significantly inhibited ACP’s response to normally attractive citrus host-plant volatiles. A similar level of inhibition was recorded when synthetic DMDS was co-released with volatiles from citrus leaves. In addition, the volatile mixture emanating from a combination of intact citrus and intact guava leaves induced a knock-down effect on adult ACP suggesting toxicity of guava volatiles to this insect. We quantified the airborne concentration of DMDS that induced the behavioral effect in the laboratory behavioral tests and found it to be 107pg/cc. Compounds similar to DMDS including dipropyl disulfide, ethyl-1-propyl disulfide, and ethyl disulfide did not affect the behavioral response of ACP to attractive citrus host plant volatiles in laboratory behavioral tests. These data suggest that the activity of DMDS on the behavior of ACP is unique and not shared by all disulfide compounds. However, much more work is needed to determine whether blends of guava-released chemicals are more potent than single components. Also, it is possible that DMDS-related compounds may show behavioral activity at elevated dosages as compared with DMDS. Head-space volatile analyses were conducted to compare volatile profiles of citrus and guava using gas chromatography-pulsed flame photometric detector and -mass spectrometry techniques. Eleven guava-specific, 15 citrus-specific and 17 shared compounds were identified. Several possible candidate compounds were identified during this process that require further testing on ACP behavior and mortality. A field trial was conducted to test the effect of synthetic DMDS released from polyethylene vials on population densities of ACP. The treatments compared were plots treated with DMDS versus untreated control plots. Fifteen ml of synthetic DMDS was formulated per polyethylene vial. This release device was developed with one of our industry partners (Alpha Scents, West Linn, OR). In this initial field experiment, populations of ACP were significantly reduced by deployment of synthetic DMDS from the polyethylene vials compared with untreated control plots. Our small plot field experiment confirmed the results of our laboratory olfactometer assays. Deployment of synthetic DMDS from polyethylene vials reduced populations of ACP in an unsprayed citrus orchard for up to 3 weeks following deployment. Given that population densities were equivalent among plots prior to the deployment of DMDS treatments, we hypothesize that DMDS repelled adult ACP from treated plots. By the fourth week, there was no remaining DMDS in the polyethylene vials, which likely explains why populations were once again equivalent in treated and control plots by the fourth week of the trial. Given the volatility of DMDS, one of the main obstacles to the development of a practical DMDS formulation for ACP management will be development of a slow-release device that maintains the chemical above a behaviorally active threshold for long periods. Ideally, a slow-release device should be developed that could achieve 150-200 d of behaviorally efficacious release. In summary, volatiles from guava inhibit the response of ACP to citrus host plant volatiles. Our results indicate that synthetic DMDS may explain guavaÕs behavioral activity against ACP. DMDS, a guava-released metabolite, appears to be a potential candidate repellent for ACP. Our current on-going efforts include formulating DMDS into controlled release devices for extended release of the chemical in the field. Control of ACP with behavioral modification may be one potential tool for management of this plant disease vector.



Quantitative measurement of the movement patterns and dispersal behavior of Asian citrus psyllid in Florida for improved management

Report Date: 06/25/2009   Project: 72359

Quantitative measurement of the movement patterns and dispersal behavior of Asian citrus psyllid in Florida for improved management

Report Date: 06/25/2009
Project: 72359
Category: ACP Vector

The movement patterns and dispersal capabilities of Asian citrus psyllid (ACP) required investigation to better understand the spread of huanglongbing (HLB) and to improve management strategies for ACP. Recently, we adopted an immunomarking technique which utilizes crude food proteins (chicken egg albumin, bovine casein, and soy protein) to track the movement of ACP in Florida citrus. In general, both egg and milk protein markers exhibited longer residual activity (35 d) than the soy protein marker (20 d) when applied to citrus leaves. However, residues of all three protein markers decreased with a simulated rain; this was more pronounced for soy protein than for egg and milk proteins. Temperature did not significantly affect acquisition of markers by adult ACP. Egg, milk, and soy protein markers were detected on >90% of adult ACP for up to 10, 10, and 5 d, respectively, post field application. Addition of tetrasodium ethylenediamine tetraacetic acid (water softener) and/or Silwet L-77 (wetting agent) to marker solutions did not affect longevity of detection. Each of the protein markers was detected on ³80% of exposed ACP for up to 30 d after direct application to adults. After development of the marking technique, we have conducted several field investigations to understnad how psyllids move. In our initial field studies, we measured the movement of ACP between replicated pairs of managed and unmanaged citrus groves separated by 60-100 yards. Approximately 70% of captured psyllids were found marked 3 d after application of proteins in the field. Using two marker proteins, we determined that ACP moved bi-directionally between managed and abandoned groves within 3 d with net movement from unmanaged into managed plots. These data indicate frequent movement by adult ACP between groves and suggest that unmanaged groves may act as refuge sites for ACP leading to re-infestation of nearby managed groves. Our most recent data suggest that the majority of this back-and-fourth movement between groves is restricted to the first 3-4 rows of the grove borders and that psyllid populations are much higher on grove borders than in the interior of groves. This “border effect” suggests that grove borders should be monitored more intensely than grove interiors and that supplemental border sprays should improve psyllid management. A recent more detailed investigation of the movement patterns of ACP from abandoned into managed groves revealed that approximately 65% of the marked and captured ACP moved from abandoned borders to managed borders; 10% moved from abandoned interiors to managed borders; 20% moved from abandoned borders into managed interiors; and 5% moved from abandoned interiors into managed interiors. These data confirm that most of the movement occurs between grove borders. However, it also shows that ACP can infest grove interiors up to 60 yards of the grove border within 4-7 days. In addition, approximately 65% of those ACP found moving were females and 35% were males. It is possible that females disperse from abandoned into managed groves in greater frequency in search of optimal sites for egg laying. In summary, ACP movement is biased in the direction from abandoned or marginally managed groves into well managed groves; ACP are capable of moving back and forth between 2 groves separated by 100 yards within 2 days; ACP are capable of invading up to 60 yards into managed grove interiors within 4-7 days; ACP move even when there is abundant flush (food/egg laying sites) available; most invading ACP are found in the first 3-4 rows of trees from the plot borders, but are capable of invading; female ACP appear to move more than males. We have confirmed that abandoned groves are a problem and negatively impact managed groves. Current studies are focusing on determining whether abandoned groves serve as a source of HLB infection. Both psyllids and trees in abandoned groves are being investigated. Also, we are investigating whether HLB infection impacts ACP movement. In addition, the seasonality of ACP movement is continuously under investigation to optimize an ACP spray calendar.



Control of the Asian citrus psyllid, Diaphorina citri Kuwayama with protease inhibitors and RNAi

Report Date: 06/08/2009   Project: 72711

Control of the Asian citrus psyllid, Diaphorina citri Kuwayama with protease inhibitors and RNAi

Report Date: 06/08/2009
Project: 72711
Category: ACP Vector

Our research project is directed towards controlling adult and nymph psyllids by using biorational and genetically engineered factors and Long Hairpin (lh)RNA. We propose to develop a novel TMOF and RNAi technologies that target proteases and other important physiological events in the gut of psyllids. In order to achieve this goal, we prepared EST libraries to find out the important digestive enzymes that psyllids use to digest their food. The most abundant digestive enzymes found in the EST libraries are cathepsins F, B and L. Our EST library also identified several other key molecules that are essential for adult and nymph growth and development like alpha-Tubulin important in cells growth and division, and vacuolar ATPAse that is important in water and ion transport through the gut. Using the sequences that are available to us from the EST libraries seventeen DNA molecules of 300 nt flanked at the 5′ and 3′ by T7 promoters were synthesized and cloned into pUC57 plasmid. We are at the moment sequencing the plasmids and using restriction enzyme analysis to show that the sequences are correct. Once the sequences are confirmed we will use RNA polymerase to convert the DNA into dsRNA. In parallel, our collaborators at the USDA and at the University of Florida in Ft Pierce were successful in maintaining a healthy psyllid colony for feeding tests. These insects can be artificially fed through a membrane with various nutrients and can be kept alive for up to 10 days allowing us to test the lethal effect of our dsRNAs and protease inhibitors on adult and nymph psyllids. The second thrust of AIM1 in our funded project is to produce proteins and peptide hormones (for example, TMOF) that can be used to inhibit food digestion in adults and nymphs. Because our EST libraries indicate that the major digestive enzymes in the gut are cathepsin like enzymes, we have cloned and expressed a specific cystein protease inhibitor, that we have discovered in the gut of the citrus weevil, Diaprepes abbreviatus. The inhibitor was expressed in E. coli and bacterial cells were grown for 24 h at room temperature to prevent non-specific precipitation of the recombinant protein in the bacterial inclusion bodies. Cells were broken and supernatants were purified by Nickel affinity chromatography. About 3.0 mg of the inhibitor were harvested and aliquots characterized by SDS polyacrylamide gel electrophoresis. The protein migrated as a single band on the gel indicating that the protein was at least 90% pure. Some of the protein was sent to the University of Florida Biotechnology Institute and mass spectrometry analysis confirmed that the protein is indeed cystein protease inhibitor. The protein was incubated with crude cathepsins gut homogenates from psyllids and Diaprepes. About 200 to 5000 ng of the recombinant protease inhibitor completely stopped cathepsin activity in the crude extracts for hours. These results indicate that we can now start using our artificial feeder to test the effect of the protease inhibitor on psyllids growth and development. In summary we : 1. Cloned potential dsRNA molecules that are essential for cell growth, water and ions balance and digestion. 2. Bio-engineered E. coli with a cystein protease inhibitor, stimulated the bacteria to produce the protein, purified and characterized the protein. 3. Developed a feeding apparatus that allows us to test bio-engineered dsRNA molecules and protease inhibitors.



Optimizing Chemical Control of Asian Citrus Psyllid in California

Report Date: 06/11/2006   Project: 5500-189

Optimizing Chemical Control of Asian Citrus Psyllid in California

Report Date: 06/11/2006
Project: 5500-189
Category: ACP Vector
Author: Joseph Morse
Sponsor: California Citrus Research Board

We have initiated research in UCR’s Quarantine facility working with Drs. Mark Hoddle and Raju Pandey on screening registered organic products against ACP. This will continue but at a slow pace because space in Quarantine is limited as is the number of ACP available each week for bioassay research. Dr. Frank Byrne also has initiated trials in Quarantine with neonicotinoids and ACP via collaboration with CRB project 5500-190 (Luck & Forster). Research is also planned at the Chula Vista location in San Diego County once all approvals for such work are obtained. This site is a bit larger and would allow us to make more rapid progress on project objectives. The Chula Vista facility is a secure greenhouse composed of two greenhouse rooms, each with double door entry into a central anteroom, secured by an outside, padlocked door. At Chula Vista, we will rear a California strain of ACP (probably from the LA infestation collected and transported to Chula Vista under containment according to permit protocols) and be able to do more extensive testing than is possible at UCR. A substantial amount of time and effort has been spent by Co-PI Bethke and Project Technician Whitehead in upgrading the Chula Vista facility so that it is functional and meets the standards requested by CDFA, the San Diego Agricultural Commissioner’s Office, the ACP Science & Technology Advisory committee, the CPDPC, and the project team itself (we are sometimes our own harshest critics). Many, many people suggested changes and improvements to our initial proposal and protocols and we thank all of them for contributing to this effort. There have been multiple discussions, conference calls, sending of protocols and procedures back and forth for additions and modifications, and two inspections to date by CDFA (the most recent was a second on-site inspection by CDFA State Entomologist Dr. Kevin Hoffman on 26 May 2011). We hope we are very close to permits being approved to (1) collect live ACP from a CA infestation (probably LA area) and transport it safely to the Chula Vista facility, (2) move untreated plant material within the plant movement Quarantine zone to the site to be used in rearing, and (3) to rear ACP at the site. We have every expectation of doing this safely so that ACP will not escape containment. No plant or other material will leave the site without being held for 4 days in a -45’F freezer followed by an additional 4 days of solarization; treated plant material will be double bagged prior to disposal. Plants and insects inside the colony will be randomly selected once a month for testing for HLB by the CRB laboratory in Riverside. In the event HLB were detected at the site, we anticipate destroying all plant and insect material at the site according to the above treatment protocol (perhaps with added procedures). We are quite excited about the possibility of soon initiating research at the Chula Vista facility and when it is functional, plan a conference call of PI’s to prioritize initial research efforts.



Optimizing Chemical Control of Asian Citrus Psyllid in California

Report Date: 07/12/2004   Project: 5500-189

Optimizing Chemical Control of Asian Citrus Psyllid in California

Report Date: 07/12/2004
Project: 5500-189
Category: ACP Vector
Author: Joseph Morse
Sponsor: California Citrus Research Board

This is a cooperative research project between Co-PIs Joseph Morse, Jim Bethke, Frank Byrne, Beth Grafton-Cardwell, and Kris Godfrey. One objective is to coordinate with researchers working on chemical control of ACP in Florida, Texas, Arizona, and elsewhere. Towards that end, Morse and Godfrey participated in the Second Citrus Health Research Forum in Denver in October 2011 and we regularly stay in touch with other researchers conducting similar research. We are rearing ACP in a contained greenhouse at the Chula Vista Insectary (San Diego County; about 6 miles north of the Mexican border) under permit (#2847) from CDFA . This permit clearly notes experimental protocols and procedures so that the work is done as safely as possible to minimize any chance of ACP escape. The facility is double padlocked, entry is restricted to trained project personnel, and used plants are disposed of only after 4 days of treatment in a -45’C freezer followed by 4 additional days of solarization before the double-bagged plants are disposed of. To initiate the ACP colonies, we collected insects from an infestation in Boyle Heights on October 27, 2011 and transported them to Chula Vista under a second permit from CDFA. Both plants and ACP have been tested for HLB on a number of occasions by the USDA-certified CRB laboratory in Riverside. The ACP colony struggled somewhat during the winter months but it is now building up nicely and our first trial was initiated 30 January 2012. To date, Dr. Byrne has run three trials evaluating the impact of imidacloprid on ACP, comparing our results to those published by Setamou et al. (2010). The first of these trials were done at Chula Vista and the latter two at UC Riverside. Dr. Byrne plans additional trials evaluating other neonicotinoids such as thiamethoxam and clothianidin. Priorities for testing at the Chula Vista facility over the near future include a number of experimental products targeted for organic registration in comparison with organic and non-organic standards.



Optimizing Chemical Control of Asian Citrus Psyllid in California

Report Date: 09/11/2002   Project: 5500-189

Optimizing Chemical Control of Asian Citrus Psyllid in California

Report Date: 09/11/2002
Project: 5500-189
Category: ACP Vector
Author: Joseph Morse
Sponsor: California Citrus Research Board

This is a cooperative research project between Co-PIs Joseph Morse, Jim Bethke, Frank Byrne, Beth Grafton-Cardwell, and Kris Godfrey. One objective is to coordinate with researchers working on chemical control of ACP in Florida, Texas, and elsewhere. Towards that end, Byrne, Grafton-Cardwell, and Morse travelled to the HLB conference in Orlando in January 2011, listened to progress on HLB and ACP research, and coordinated with other researchers in the development of a USDA-NIFA joint grant proposal from FL, CA, and TX focusing on ACP resistance management / optimization of chemical control, which was submitted 1-21-11 with letters of support obtained from CRB (Batkin and board members Gorden and Barcinas), CCQC (Cranney), CDFA (Bezark), and CCPDPC (Hill). Discussions with regulators about where and how to conduct studies on ACP in CA began late last year. After consultation with, and with assistance from, the San Diego Agricultural Commissioner’s Office, Godfrey, Bethke, and Morse visited the San Diego County Insectary in Chula Vista on 12-12-10 with CDFA State Entomologist Dr. Kevin Hoffman to investigate whether we could safely conduct research trials on ACP at that facility. The Insectary was previously used to study the avocado lace bug (ALB), a similar sized insect, when research could not be done at UC Riverside, which was outside the ALB quarantine area. The group viewing the containment greenhouse 12-12-10 decided we needed additional measures to ensure containment, we developed a written protocol dictating changes that would make to the facility, and we outlined methods to sterilize anything that would leave the facility (4 days at -45’F followed by 4 days heat sterilization inside double bagging). We are working on facility improvements and are continuing to solicit input on containment procedures prior to our soon requesting a permit from CDFA to collect ACP somewhere in CA (probably inside the Los Angeles infestation), transport live insects to the San Diego Insectary, and to rear ACP so that research specific to the CA situation can be conducted built upon research done in FL, TX, and elsewhere. We have made progress on retrofitting the San Diego County Insectary, which includes sealing all edges, doors, and vents. We are replacing the swamp coolers to ensure efficient greenhouse environmental control. We anticipate bringing plants to the facility the beginning of March and no ACP will be brought to the facility until we have satisfied possible concerns and obtained a permit to conduct the proposed work. The Co-PIs have been discussing priorities for research that might be conducted once we are approved to do the proposed work. We anticipate holding regular conference calls to prioritize research and would be receptive to industry input on such priorities.



Impact of insecticidal control of Asian citrus psyllid (ACP) on leafminers, mites, scales, thrips and their natural enemies in Florida

Report Date: 01/08/2001   Project: 76787

Impact of insecticidal control of Asian citrus psyllid (ACP) on leafminers, mites, scales, thrips and their natural enemies in Florida

Report Date: 01/08/2001
Project: 76787
Category: ACP Vector
Author: Jawwad Qureshi
Sponsor: Citrus Research and Development Foundation

The main objective of the project is to evaluate impact of psyllid control programs on non target pests and beneficial insects in citrus groves. During this quarter two replicated trials were conducted in 15 yr old Valencia orange trees at the Southwest Florida Research and Education Center (SWFREC). First trial compared low vs. high volume applications of Movento 240 SC along with Mustang Max 1.5 EC, Baythroid XL 1 EC, Provado 1.6 F, and Agrimek 0.15 EC using Proptec and air blast speed sprayer. All treatments provided significant reduction in psyllid adults through 18 days after treatment (DAT) and nymphs through 25 DAT except Mustang Max 1.5 EC against nymphs at the last observation. All treatments reduced citrus leafminer (CLM) populations through 11 DAT, one to two weeks earlier than the control of ACP. Significantly more CLM larvae and less empty mines on trees treated with Agrimek 0.15 EC + Provado 1.6 F + 435 Oil than untreated trees were observed at 25 DAT. More ants or spiders were found on these trees compared to all other treated trees at 4 and 25 DAT, respectively. There were no differences in numbers of these predators between treated and untreated trees on other sampling dates. At 20 DAT, citrus rust mite populations were significantly lower in all treated trees than the untreated check. Most reduction was observed with Movento 240 SC + 435 Oil (10 oz + 3 gal in 40 gpa with Airblast) treatment, although not significantly more than other treatments except Baythroid XL 1 EC (3 oz in 5 gpa with Proptec). The second trial evaluated treatments of two rates each of Imidan and Nexter, four rates of Lorsban 4 E with 435 Oil, and 435 Oil alone using air blast sprayer. Psyllid populations were low and treatment effects were minimal with a trend toward reduction in ACP nymphs at 5 DAT with all treatments except 435 Oil alone (2 gal/ac), Imidan (1.5 lb/ac), and Nexter (6.6 oz or 9.9 oz/ac). CLM larvae, empty mines, spiders and ants were equally abundant in treated and untreated trees. We are also monitoring populations of citrus blackfly and cloudywinged whitefly and their parasitoids in a replicated trial in a 16 acre block of ‘Valencia’ oranges in Hendry county comparing a calendar based spray program for ACP and untreated check. An organophosphate Dimethoate at 24 oz per acre was applied in the second week of October in plots designated for calendar treatment. Two weeks later ACP adults averaged 0.01 per tap sample and did not differ between treated and untreated trees. However, there were 73% shoots and 25% leaves infested with citrus blackfly eggs and nymphs in treated plots: significantly more than 50% shoots and 10% leaves in untreated plots. Percentages of shoots and leaves infested with cloudywinged whitefly nymphs averaged 36% and 6% in the treated plots and 41% and 6% in the untreated plots and did not differ significantly. Blackfly parasitism averaged 83% and 73% in November in treated and untreated trees, respectively, based on numbers of adults emerging from blackfly nymphs. However, parasitism in treated trees averaged 50% compared to 100% in untreated trees in December. Among parasitoids, 92% belonged to genus Encarsia and 8% to Amitus. Although, very few blackfly adults emerged in the samples collected from field and reared in the laboratory, we are seeing high numbers captured on sticky cards along with parasitoids. Those data are being collected and will be presented later. We also plan to monitor cohorts of these flies and of ACP and CLM in the above treatments to study the impact of predaceous and parasitic arthropods in each plot and evaluate their relationship with intensity of insecticide use. Additionally, we are also monitoring infestations of Florida red scale and lesser snow scale in commercial groves.



Report Date: 06/04/2026   Project: 24-010   Year: 2025

Report Date: 06/04/2026
Project: 24-010   Year: 2025
Percentage Completion: 0.1
Category: ACP Vector
Author: Clive Bock
Sponsor: Citrus Research and Development Foundation

1. Please state project objectives and what work was done this quarter to address them:
The purpose of the project is to characterize the distance of spread of citrus black spot (CBS) in groves in FL relative to the known source of inoculum. The information is fundamental to a data-based approach to delineating risk of spread under FL conditions based on current quarantine regulation. The goal of the first quarter of the first season was to establish some of the planned field experiments and obtain preliminary data. The collaborating citrus producer provided grove space, which is close to Immokalee, and in a citrus black spot (CBS) quarantined area. The experiments are being implemented in 3 different groves. Progress on the objectives is as follows:
1. Characterize spore production and splash dispersal distance for P. citricarpa: A preliminary experiment was initiated for this objective. Trap plants were placed at different distances from four CBS diseased trees to collect spores of the CBS pathogen, Phyllosticta citricarpa. The trap plants were replaced every two weeks following protocol. Preliminary qPCR analysis using established primers and probes indicated the presence of the pathogen on some sample leaves. The experiment will be continued throughout the year, to monitor spore production during the period of new fruit crop susceptibility. An additional experiment was initiated in an open area of the grove, placing diseased fruit in net bags on poles, with trap plants forming a cross in the four cardinal directions at different distances from the inoculum source. These samples have been taken and are being processed. The quantity of the pathogen dispersed different distances will be measured using qPCR.
2. Determine the likely distances of CBS spread: Trees were identified and marked for this experiment to be commenced in Q2.
3. Ascertain the role of leaf litter as a source of conidia: Trees were identified for this experiment to be commended in Q2.
4. Ascertain the spatial characteristics of CBS epidemics in Florida: For this objective, eighty-seven individual trees were assessed to quantify CBS aggregation as an indicator of distance of dispersal. Quadrats (0.75 m2) were used to count healthy and diseased fruit at five locations in each the upper and lower canopy (due to tree size it was not possible to include a mid-canopy height). So far, a total of 4,250 fruit have been assessed. These data have been entered into a spreadsheet. More trees will be sampled in Q2 and in Y2. Although analysis has not been completed, the indications are that the disease is aggregated, with more CBS-infected fruit in the lower parts of the canopy. Additional studies on the relationship between incidence and severity of the disease have been initiated to indicate the nature of the relationship. A high severity at low incidence is indicative of short distance spread (97 trees have been sampled so far).

2. Please state what work is anticipated for next quarter:
Next quarter will include continuing objective 1 studies, and extend these to include dispersal of a CBS surrogate in the experimental wind tunnel to better understand dispersal capabilities. Pathogen quantification using qPCR will be refined. Objective 2 and 3 studies will be commenced. Objective 4 data acquisition will continue. Data entry will continue.

3. Please state budget status (underspend or overspend, and why):
Budget status: The funding is in place and the funds are being used for project consumables and project personnel needs.



Pathogen-Vector Relations between Asian Citrus Psyllid and Liberibacter asiaticus

Project: 93

Pathogen-Vector Relations between Asian Citrus Psyllid and Liberibacter asiaticus

Project: 93
Category: ACP Vector

1: Testing various techniques for localization of Liberibacter asiaticus (Las) in internal organs of Asian citrus psyllid (ACP). In order to study the cellular interactions of Las in its psyllid vector, the following three techniques have been tested for localization of this bacterium in dissected organs of ACP and in leaf sections and extracts of HLB-diseased plants: A. Immunofluorescence confocal laser scanning microscopy using polyclonal and monoclonal antibodies. Two polyclonal antibodies (A and B), a mixture of both (C), and a mixture of three monoclonal antibodies prepared against Las membrane proteins have been tested at various dilutions (1/20 to 1/400) and incubation times (3-24 hrs). However, no specific fluorescence associated with Las bacterium was detected in insect organs or leaf sections. B. Fluorescence In situ hybridization (FISH) based on oligonucleotide primers of the Las bacterium. Two oligonucleotide primers based on the following sequences of Las were tagged with Alexa Fluor 488: Primer 1 (20 bases): TCGAGCGCGTATGCAATACG; Primer 2 (30 bases): TCCCTATAAAGTACCCAACATCTAGGTAAA. So far, we tested primer 1 above, using several FISH protocols on dissected organs of ACP and on leaf sections and extracts from healthy and HLB-diseased citrus plants. Carnoy’s fixative coupled with TBS washing produced the best results. Green fluorescence, indicating Las, was detected in the filter chamber and midgut of field-collected ACP, but not in healthy controls form the lab colony. It was also detected in leaf sections and plant extracts from HLB-diseased plants but not in those from healthy plants. We will replicate these experiments further to confirm these results and to refine the FISH procedure if required. We will also test the second primer (above) in future experiments. C. Quantitative RT-PCR of dissected insect organs from individual ACP. Currently, RT-PCR has been the most reliable method for detecting Las in diseased plants and in vector ACP. However, to our knowledge, RT-PCR has only been applied to whole insects but not to insect organs of ACP. Thus, we investigated whether RT-PCR can be used to detect Las in the salivary glands and alimentary canals of individual ACP adults. In two experiments, RT-PCR detected Las in 7/24 (29%) of the salivary glands, 6/24 (25%) of the alimentary canals and 7/24 (29%) of the rest of the body of field collected insects, compared to 0/8 similar organs from each healthy control insect. Thus, we plan to use RT-PCR, FISH and other techniques to study the route, replication and transmission barriers of Las in its psyllid vector at the cellular, tissue and organ levels. 2. Testing the ability of field collected ACP to infect citrus species/varieties. Forty young citrus trees (Duncan grapefruit) growing in pots were each infested by 10 field-collected adults. After one week, these psyllids were removed and tested by RT-PCR. Three plants were dropped from the study because none of the psyllids recovered from them tested positive for Las. Among the other 37 plants, the percentage of psyllids that tested positive from each plant ranged from 12.5 to 71.4% with an overall mean of 36.5%. The plants were tested monthly for Las using RT-PCR. Eleven percent of the plants tested positive within one month. The percentage of plants testing positive for the pathogen increased to 30, 41, 43, and 46% at 2, 3, 4, and 5 months, and 57% of the plants tested positive during the 9th and 10th months after infestation. The experiment is being continued, and two similar studies were initiated with other citrus varieties. 3. Establishing new vector-efficient ACP colonies. Our ACP lab colony, established during 2000, has been maintained without adding wild types. Recently, tests indicate that insects from this lab colony acquire and transmit the HLB pathogen at much lower rates than field-collected ACP. New disease-free colonies have been established from field-collected ACP, and the ability of these to acquire and transmit HLB is being studied.



CAN INSECTICIDES AND MINERAL OIL AVOID TRANSMISSION OF Candidatus Liberibacter asiaticus BY Diaphorina citri?

Project: 236

CAN INSECTICIDES AND MINERAL OIL AVOID TRANSMISSION OF Candidatus Liberibacter asiaticus BY Diaphorina citri?

Project: 236
Category: ACP Vector

The first experiment that was conducted to know the efficiency of systemic insecticides to control the Asian Citrus Psyllid (ACP), Diaphorina citri, and its effect on transmission of the bacteria Candidatus Liberibacter asiaticus, indicated that imidacloprid (Confidor 700 GrDA), 0.35 g AI/plant and thiamethoxam (Actara 250 WG) 0.25 g AI/plant, applied in the nursery tree bags, before planting, was efficient to control ACP until 60 days after application. The time to cause 100% of ACP mortality was between 5 to 7 days after the confinement of adults in treated plants. However, researches using electrical penetration graph (EPG) showed that in plants treated with imidacloprid and thiamethoxam, after the first feeding on phloem, the adults do not do more probing. We carried out the first PCR of the plants in this experiment and the results were negative, in no plants have been detected the presence of the bacterium L. Ca asiaticus. No transmission results yet. We finished the second experiment that was performed to determine if the systemic insecticides are effective until 90 days after application and its effect on transmission of the bacteria. In this experiment, the time to reach 100% of mortality ranged from 3 to 7 days for both systemic insecticides tested (imidacloprid and thiamethoxam). The insecticides were effective up to 90 days after application. The results of PCR carried out for the ACP, in some periods, were positive for 100% of the samples, consisting of 10 insects tested, but in the confinement held at 46 days after application, in any sample was detected the presence of the bacteria. No acquisition in this period. In bioassays performed at 75 and 90 days after application, the percentage of positive samples was 50 to 70% and 10 to 40%, respectively. We started the experiment 2, and the difference from the experiment 1 is the application of varying doses of the systemic insecticides and confinement of the ACP in plants treated only 7 days after application. To thiamethoxam (Actara 250 WG), the doses tested were: 1, 0.5, 0.1 and 0.05 g/nursery tree and imidacloprid (Provado 200 SC) were: 1.75, 0.9, 0.2 and 0.08 mL/nursery tree. We also started the experiment 3, using different insecticide spraying to determine if they prevent the transmission and for how long. Using electrical penetration graphs (EPG) techniques, we are studying the probing behavior of ACP. In plants treated with insecticide, the proportion of insects reaching the phloem was similar among plants treated with imidacloprid (0.35 g AI/tree), thiamethoxam (0.25 g AI/tree) and control (untreated plants), being respectively 74, 72 and 76%. The time to perform the first ACP salivation was also similar among treatments, 118.4, 103.2, and 112.6 minutes, respectively. However, the time of phloem ingestion is drastically reduced compared to untreated plants: imidacloprid 6.1, 9.9 and 6.9 min, respectively for 15, 35 and 95 days after application (DAA); thiamethoxam 9.6, 14.5 and 17.5 min, respectively for 15, 35 and 95 DAA; Control 142.0, 80.3 and 129.0 minutes, respectively for 15, 35 and 95 DAA. Apparently, ACP can only distinguish among plants with and without treatment from the moment that started the ingesting of the phloem sap. In this case, it was observed that after the ingestion of sap with insecticide, the ACP removed the stylet from the plant and rarely returned to start a new probe on the same plant. In plants sprayed with mineral oil, decreased the percentage of psyllids that could reach the phloem when compared with plants not sprayed, 20 and 70% respectively. However, the few insects that reached the phloem of treated plants carried out long periods of ingestion in this vascular tissue (‘ 1 h).



Efficacy of seasonal insecticide programs for suppressing HLB in new citrus plantings

Project: Hall-91

Efficacy of seasonal insecticide programs for suppressing HLB in new citrus plantings

Project: Hall-91
Category: ACP Vector
Author: David Hall
Sponsor: Citrus Research and Development Foundation

USDA-ARS Experiment #1. Three potential psyllid management programs were investigated for protecting a new planting of citrus: (1) citrus subjected to an intensive insecticide program (annual chemical cost of $198/acre); (2) citrus interplanted with orange jasmine, with citrus subjected to a moderate insecticide program and jasmine not treated with insecticides (annual chemical cost of $156/acre); and (3) citrus interplanted with jasmine, with citrus subjected to a moderate insecticide program and jasmine regularly treated with insecticides (total annual chemical cost of $213/acre). Trees for the experiment were planted at the USDA-ARS citrus grove during May 2008 in east central Florida near Fort Pierce. Many trees at this grove were already infected by HLB when the new plantings were established, for research purposes most infected trees were not being removed, and also for research purposes much of the grove was only subjected to a minimal psyllid control program. The new citrus plantings for the experiment were therefore in the midst of high psyllid pressure and HLB inoculum. The trees were assayed for HLB quarterly, and trees testing RTPCR-positive for HLB (CT 30) were immediately removed. Numbers of psyllid captured on yellow sticky traps deployed in citrus trees indicated that relatively good psyllid control has been achieved under the intensive insecticide program. Under the reduced insecticide program for citrus interplanted with jasmine, relatively poor control of psyllids has been achieved in citrus whether jasmine was treated or not treated with pesticide (although psyllid levels in citrus were lower in plots where jasmine was treated). Numbers of psyllid on traps deployed in jasmine were frequently greater in plots where jasmine was not treated with insecticide. Lady beetles (species known to be predators of the psyllid) were relatively abundant in jasmine plants whether jasmine was treated or not treated with pesticide. Although less than 1% of the trees under each treatment tested positive for HLB 12 months after planting, during August 2010 (27 months after planting), the percentage of trees infected by HLB under treatments 1, 2 and 3 averaged 27, 33, and 30%, respectively. Based on these results, planting new citrus trees and getting them to a producing stage is difficult if HLB is endemic in the surrounding area and psyllids are not controlled across this area. USDA-ARS Experiment #2. Three ACP control programs are being compared for preventing HLB in a block of young, HLB-free citrus (Val on Carr): 1) citrus under a relaxed insecticide program (annual chemical cost of $173/acre); 2) citrus receiving monthly insecticide applications (annual chemical cost of $198/acre); and 3) citrus treated once every three weeks with spray oil [PureSpray Foliar (470, C27) and PureSpray Green (435, C23)] from February through November (plus a December application of Danitol) (annual chemical cost of $76/acre). There are two replications of each treatment. The experiment started in August 2009. In January 2010, 0%, 0.3% and 0.3% of the trees tested HLB positive under programs 1, 2 and 3, respectively. In July 2010, 25%, 7% and 10% of the trees tested positive under the three treatments. Infected trees are not removed in this experiment. UF Experiments – Updates on these experiments will be presented in the next quarterly report.