ACP Vector


Optimizing Chemical Control of Asian Citrus Psyllid in California

Report Date: 06/11/2006   Project: 5500-189

Optimizing Chemical Control of Asian Citrus Psyllid in California

Report Date: 06/11/2006
Project: 5500-189
Category: ACP Vector
Author: Joseph Morse
Sponsor: California Citrus Research Board

We have initiated research in UCR’s Quarantine facility working with Drs. Mark Hoddle and Raju Pandey on screening registered organic products against ACP. This will continue but at a slow pace because space in Quarantine is limited as is the number of ACP available each week for bioassay research. Dr. Frank Byrne also has initiated trials in Quarantine with neonicotinoids and ACP via collaboration with CRB project 5500-190 (Luck & Forster). Research is also planned at the Chula Vista location in San Diego County once all approvals for such work are obtained. This site is a bit larger and would allow us to make more rapid progress on project objectives. The Chula Vista facility is a secure greenhouse composed of two greenhouse rooms, each with double door entry into a central anteroom, secured by an outside, padlocked door. At Chula Vista, we will rear a California strain of ACP (probably from the LA infestation collected and transported to Chula Vista under containment according to permit protocols) and be able to do more extensive testing than is possible at UCR. A substantial amount of time and effort has been spent by Co-PI Bethke and Project Technician Whitehead in upgrading the Chula Vista facility so that it is functional and meets the standards requested by CDFA, the San Diego Agricultural Commissioner’s Office, the ACP Science & Technology Advisory committee, the CPDPC, and the project team itself (we are sometimes our own harshest critics). Many, many people suggested changes and improvements to our initial proposal and protocols and we thank all of them for contributing to this effort. There have been multiple discussions, conference calls, sending of protocols and procedures back and forth for additions and modifications, and two inspections to date by CDFA (the most recent was a second on-site inspection by CDFA State Entomologist Dr. Kevin Hoffman on 26 May 2011). We hope we are very close to permits being approved to (1) collect live ACP from a CA infestation (probably LA area) and transport it safely to the Chula Vista facility, (2) move untreated plant material within the plant movement Quarantine zone to the site to be used in rearing, and (3) to rear ACP at the site. We have every expectation of doing this safely so that ACP will not escape containment. No plant or other material will leave the site without being held for 4 days in a -45’F freezer followed by an additional 4 days of solarization; treated plant material will be double bagged prior to disposal. Plants and insects inside the colony will be randomly selected once a month for testing for HLB by the CRB laboratory in Riverside. In the event HLB were detected at the site, we anticipate destroying all plant and insect material at the site according to the above treatment protocol (perhaps with added procedures). We are quite excited about the possibility of soon initiating research at the Chula Vista facility and when it is functional, plan a conference call of PI’s to prioritize initial research efforts.



Optimizing Chemical Control of Asian Citrus Psyllid in California

Report Date: 07/12/2004   Project: 5500-189

Optimizing Chemical Control of Asian Citrus Psyllid in California

Report Date: 07/12/2004
Project: 5500-189
Category: ACP Vector
Author: Joseph Morse
Sponsor: California Citrus Research Board

This is a cooperative research project between Co-PIs Joseph Morse, Jim Bethke, Frank Byrne, Beth Grafton-Cardwell, and Kris Godfrey. One objective is to coordinate with researchers working on chemical control of ACP in Florida, Texas, Arizona, and elsewhere. Towards that end, Morse and Godfrey participated in the Second Citrus Health Research Forum in Denver in October 2011 and we regularly stay in touch with other researchers conducting similar research. We are rearing ACP in a contained greenhouse at the Chula Vista Insectary (San Diego County; about 6 miles north of the Mexican border) under permit (#2847) from CDFA . This permit clearly notes experimental protocols and procedures so that the work is done as safely as possible to minimize any chance of ACP escape. The facility is double padlocked, entry is restricted to trained project personnel, and used plants are disposed of only after 4 days of treatment in a -45’C freezer followed by 4 additional days of solarization before the double-bagged plants are disposed of. To initiate the ACP colonies, we collected insects from an infestation in Boyle Heights on October 27, 2011 and transported them to Chula Vista under a second permit from CDFA. Both plants and ACP have been tested for HLB on a number of occasions by the USDA-certified CRB laboratory in Riverside. The ACP colony struggled somewhat during the winter months but it is now building up nicely and our first trial was initiated 30 January 2012. To date, Dr. Byrne has run three trials evaluating the impact of imidacloprid on ACP, comparing our results to those published by Setamou et al. (2010). The first of these trials were done at Chula Vista and the latter two at UC Riverside. Dr. Byrne plans additional trials evaluating other neonicotinoids such as thiamethoxam and clothianidin. Priorities for testing at the Chula Vista facility over the near future include a number of experimental products targeted for organic registration in comparison with organic and non-organic standards.



Optimizing Chemical Control of Asian Citrus Psyllid in California

Report Date: 09/11/2002   Project: 5500-189

Optimizing Chemical Control of Asian Citrus Psyllid in California

Report Date: 09/11/2002
Project: 5500-189
Category: ACP Vector
Author: Joseph Morse
Sponsor: California Citrus Research Board

This is a cooperative research project between Co-PIs Joseph Morse, Jim Bethke, Frank Byrne, Beth Grafton-Cardwell, and Kris Godfrey. One objective is to coordinate with researchers working on chemical control of ACP in Florida, Texas, and elsewhere. Towards that end, Byrne, Grafton-Cardwell, and Morse travelled to the HLB conference in Orlando in January 2011, listened to progress on HLB and ACP research, and coordinated with other researchers in the development of a USDA-NIFA joint grant proposal from FL, CA, and TX focusing on ACP resistance management / optimization of chemical control, which was submitted 1-21-11 with letters of support obtained from CRB (Batkin and board members Gorden and Barcinas), CCQC (Cranney), CDFA (Bezark), and CCPDPC (Hill). Discussions with regulators about where and how to conduct studies on ACP in CA began late last year. After consultation with, and with assistance from, the San Diego Agricultural Commissioner’s Office, Godfrey, Bethke, and Morse visited the San Diego County Insectary in Chula Vista on 12-12-10 with CDFA State Entomologist Dr. Kevin Hoffman to investigate whether we could safely conduct research trials on ACP at that facility. The Insectary was previously used to study the avocado lace bug (ALB), a similar sized insect, when research could not be done at UC Riverside, which was outside the ALB quarantine area. The group viewing the containment greenhouse 12-12-10 decided we needed additional measures to ensure containment, we developed a written protocol dictating changes that would make to the facility, and we outlined methods to sterilize anything that would leave the facility (4 days at -45’F followed by 4 days heat sterilization inside double bagging). We are working on facility improvements and are continuing to solicit input on containment procedures prior to our soon requesting a permit from CDFA to collect ACP somewhere in CA (probably inside the Los Angeles infestation), transport live insects to the San Diego Insectary, and to rear ACP so that research specific to the CA situation can be conducted built upon research done in FL, TX, and elsewhere. We have made progress on retrofitting the San Diego County Insectary, which includes sealing all edges, doors, and vents. We are replacing the swamp coolers to ensure efficient greenhouse environmental control. We anticipate bringing plants to the facility the beginning of March and no ACP will be brought to the facility until we have satisfied possible concerns and obtained a permit to conduct the proposed work. The Co-PIs have been discussing priorities for research that might be conducted once we are approved to do the proposed work. We anticipate holding regular conference calls to prioritize research and would be receptive to industry input on such priorities.



Impact of insecticidal control of Asian citrus psyllid (ACP) on leafminers, mites, scales, thrips and their natural enemies in Florida

Report Date: 01/08/2001   Project: 76787

Impact of insecticidal control of Asian citrus psyllid (ACP) on leafminers, mites, scales, thrips and their natural enemies in Florida

Report Date: 01/08/2001
Project: 76787
Category: ACP Vector
Author: Jawwad Qureshi
Sponsor: Citrus Research and Development Foundation

The main objective of the project is to evaluate impact of psyllid control programs on non target pests and beneficial insects in citrus groves. During this quarter two replicated trials were conducted in 15 yr old Valencia orange trees at the Southwest Florida Research and Education Center (SWFREC). First trial compared low vs. high volume applications of Movento 240 SC along with Mustang Max 1.5 EC, Baythroid XL 1 EC, Provado 1.6 F, and Agrimek 0.15 EC using Proptec and air blast speed sprayer. All treatments provided significant reduction in psyllid adults through 18 days after treatment (DAT) and nymphs through 25 DAT except Mustang Max 1.5 EC against nymphs at the last observation. All treatments reduced citrus leafminer (CLM) populations through 11 DAT, one to two weeks earlier than the control of ACP. Significantly more CLM larvae and less empty mines on trees treated with Agrimek 0.15 EC + Provado 1.6 F + 435 Oil than untreated trees were observed at 25 DAT. More ants or spiders were found on these trees compared to all other treated trees at 4 and 25 DAT, respectively. There were no differences in numbers of these predators between treated and untreated trees on other sampling dates. At 20 DAT, citrus rust mite populations were significantly lower in all treated trees than the untreated check. Most reduction was observed with Movento 240 SC + 435 Oil (10 oz + 3 gal in 40 gpa with Airblast) treatment, although not significantly more than other treatments except Baythroid XL 1 EC (3 oz in 5 gpa with Proptec). The second trial evaluated treatments of two rates each of Imidan and Nexter, four rates of Lorsban 4 E with 435 Oil, and 435 Oil alone using air blast sprayer. Psyllid populations were low and treatment effects were minimal with a trend toward reduction in ACP nymphs at 5 DAT with all treatments except 435 Oil alone (2 gal/ac), Imidan (1.5 lb/ac), and Nexter (6.6 oz or 9.9 oz/ac). CLM larvae, empty mines, spiders and ants were equally abundant in treated and untreated trees. We are also monitoring populations of citrus blackfly and cloudywinged whitefly and their parasitoids in a replicated trial in a 16 acre block of ‘Valencia’ oranges in Hendry county comparing a calendar based spray program for ACP and untreated check. An organophosphate Dimethoate at 24 oz per acre was applied in the second week of October in plots designated for calendar treatment. Two weeks later ACP adults averaged 0.01 per tap sample and did not differ between treated and untreated trees. However, there were 73% shoots and 25% leaves infested with citrus blackfly eggs and nymphs in treated plots: significantly more than 50% shoots and 10% leaves in untreated plots. Percentages of shoots and leaves infested with cloudywinged whitefly nymphs averaged 36% and 6% in the treated plots and 41% and 6% in the untreated plots and did not differ significantly. Blackfly parasitism averaged 83% and 73% in November in treated and untreated trees, respectively, based on numbers of adults emerging from blackfly nymphs. However, parasitism in treated trees averaged 50% compared to 100% in untreated trees in December. Among parasitoids, 92% belonged to genus Encarsia and 8% to Amitus. Although, very few blackfly adults emerged in the samples collected from field and reared in the laboratory, we are seeing high numbers captured on sticky cards along with parasitoids. Those data are being collected and will be presented later. We also plan to monitor cohorts of these flies and of ACP and CLM in the above treatments to study the impact of predaceous and parasitic arthropods in each plot and evaluate their relationship with intensity of insecticide use. Additionally, we are also monitoring infestations of Florida red scale and lesser snow scale in commercial groves.



Report Date: 07/29/2026   Project: 24-010   Year: 2025

Report Date: 07/29/2026
Project: 24-010   Year: 2025
Percentage Completion: 0.1
Category: ACP Vector
Author: Clive Bock
Sponsor: Citrus Research and Development Foundation

1. Please state project objectives and what work was done this quarter to address them:
The purpose of the project is to characterize the distance of spread of citrus black spot (CBS) in groves in FL relative to the known source of inoculum. The information is fundamental to a data-based approach to delineating risk of spread under FL conditions based on current quarantine regulation. The goal of the first quarter of the first season was to establish some of the planned field experiments and obtain preliminary data. The collaborating citrus producer provided grove space, which is close to Immokalee, and in a citrus black spot (CBS) quarantined area. The experiments are being implemented in 3 different groves. Progress on the objectives is as follows:
1. Characterize spore production and splash dispersal distance for P. citricarpa: A preliminary experiment was initiated for this objective. Trap plants were placed at different distances from four CBS diseased trees to collect spores of the CBS pathogen, Phyllosticta citricarpa. The trap plants were replaced every two weeks following protocol. Preliminary qPCR analysis using established primers and probes indicated the presence of the pathogen on some sample leaves. The experiment will be continued throughout the year, to monitor spore production during the period of new fruit crop susceptibility. An additional experiment was initiated in an open area of the grove, placing diseased fruit in net bags on poles, with trap plants forming a cross in the four cardinal directions at different distances from the inoculum source. These samples have been taken and are being processed. The quantity of the pathogen dispersed different distances will be measured using qPCR.
2. Determine the likely distances of CBS spread: Trees were identified and marked for this experiment to be commenced in Q2.
3. Ascertain the role of leaf litter as a source of conidia: Trees were identified for this experiment to be commended in Q2.
4. Ascertain the spatial characteristics of CBS epidemics in Florida: For this objective, eighty-seven individual trees were assessed to quantify CBS aggregation as an indicator of distance of dispersal. Quadrats (0.75 m2) were used to count healthy and diseased fruit at five locations in each the upper and lower canopy (due to tree size it was not possible to include a mid-canopy height). So far, a total of 4,250 fruit have been assessed. These data have been entered into a spreadsheet. More trees will be sampled in Q2 and in Y2. Although analysis has not been completed, the indications are that the disease is aggregated, with more CBS-infected fruit in the lower parts of the canopy. Additional studies on the relationship between incidence and severity of the disease have been initiated to indicate the nature of the relationship. A high severity at low incidence is indicative of short distance spread (97 trees have been sampled so far).

2. Please state what work is anticipated for next quarter:
Next quarter will include continuing objective 1 studies, and extend these to include dispersal of a CBS surrogate in the experimental wind tunnel to better understand dispersal capabilities. Pathogen quantification using qPCR will be refined. Objective 2 and 3 studies will be commenced. Objective 4 data acquisition will continue. Data entry will continue.

3. Please state budget status (underspend or overspend, and why):
Budget status: The funding is in place and the funds are being used for project consumables and project personnel needs.



Pathogen-Vector Relations between Asian Citrus Psyllid and Liberibacter asiaticus

Project: 93

Pathogen-Vector Relations between Asian Citrus Psyllid and Liberibacter asiaticus

Project: 93
Category: ACP Vector

1: Testing various techniques for localization of Liberibacter asiaticus (Las) in internal organs of Asian citrus psyllid (ACP). In order to study the cellular interactions of Las in its psyllid vector, the following three techniques have been tested for localization of this bacterium in dissected organs of ACP and in leaf sections and extracts of HLB-diseased plants: A. Immunofluorescence confocal laser scanning microscopy using polyclonal and monoclonal antibodies. Two polyclonal antibodies (A and B), a mixture of both (C), and a mixture of three monoclonal antibodies prepared against Las membrane proteins have been tested at various dilutions (1/20 to 1/400) and incubation times (3-24 hrs). However, no specific fluorescence associated with Las bacterium was detected in insect organs or leaf sections. B. Fluorescence In situ hybridization (FISH) based on oligonucleotide primers of the Las bacterium. Two oligonucleotide primers based on the following sequences of Las were tagged with Alexa Fluor 488: Primer 1 (20 bases): TCGAGCGCGTATGCAATACG; Primer 2 (30 bases): TCCCTATAAAGTACCCAACATCTAGGTAAA. So far, we tested primer 1 above, using several FISH protocols on dissected organs of ACP and on leaf sections and extracts from healthy and HLB-diseased citrus plants. Carnoy’s fixative coupled with TBS washing produced the best results. Green fluorescence, indicating Las, was detected in the filter chamber and midgut of field-collected ACP, but not in healthy controls form the lab colony. It was also detected in leaf sections and plant extracts from HLB-diseased plants but not in those from healthy plants. We will replicate these experiments further to confirm these results and to refine the FISH procedure if required. We will also test the second primer (above) in future experiments. C. Quantitative RT-PCR of dissected insect organs from individual ACP. Currently, RT-PCR has been the most reliable method for detecting Las in diseased plants and in vector ACP. However, to our knowledge, RT-PCR has only been applied to whole insects but not to insect organs of ACP. Thus, we investigated whether RT-PCR can be used to detect Las in the salivary glands and alimentary canals of individual ACP adults. In two experiments, RT-PCR detected Las in 7/24 (29%) of the salivary glands, 6/24 (25%) of the alimentary canals and 7/24 (29%) of the rest of the body of field collected insects, compared to 0/8 similar organs from each healthy control insect. Thus, we plan to use RT-PCR, FISH and other techniques to study the route, replication and transmission barriers of Las in its psyllid vector at the cellular, tissue and organ levels. 2. Testing the ability of field collected ACP to infect citrus species/varieties. Forty young citrus trees (Duncan grapefruit) growing in pots were each infested by 10 field-collected adults. After one week, these psyllids were removed and tested by RT-PCR. Three plants were dropped from the study because none of the psyllids recovered from them tested positive for Las. Among the other 37 plants, the percentage of psyllids that tested positive from each plant ranged from 12.5 to 71.4% with an overall mean of 36.5%. The plants were tested monthly for Las using RT-PCR. Eleven percent of the plants tested positive within one month. The percentage of plants testing positive for the pathogen increased to 30, 41, 43, and 46% at 2, 3, 4, and 5 months, and 57% of the plants tested positive during the 9th and 10th months after infestation. The experiment is being continued, and two similar studies were initiated with other citrus varieties. 3. Establishing new vector-efficient ACP colonies. Our ACP lab colony, established during 2000, has been maintained without adding wild types. Recently, tests indicate that insects from this lab colony acquire and transmit the HLB pathogen at much lower rates than field-collected ACP. New disease-free colonies have been established from field-collected ACP, and the ability of these to acquire and transmit HLB is being studied.



CAN INSECTICIDES AND MINERAL OIL AVOID TRANSMISSION OF Candidatus Liberibacter asiaticus BY Diaphorina citri?

Project: 236

CAN INSECTICIDES AND MINERAL OIL AVOID TRANSMISSION OF Candidatus Liberibacter asiaticus BY Diaphorina citri?

Project: 236
Category: ACP Vector

The first experiment that was conducted to know the efficiency of systemic insecticides to control the Asian Citrus Psyllid (ACP), Diaphorina citri, and its effect on transmission of the bacteria Candidatus Liberibacter asiaticus, indicated that imidacloprid (Confidor 700 GrDA), 0.35 g AI/plant and thiamethoxam (Actara 250 WG) 0.25 g AI/plant, applied in the nursery tree bags, before planting, was efficient to control ACP until 60 days after application. The time to cause 100% of ACP mortality was between 5 to 7 days after the confinement of adults in treated plants. However, researches using electrical penetration graph (EPG) showed that in plants treated with imidacloprid and thiamethoxam, after the first feeding on phloem, the adults do not do more probing. We carried out the first PCR of the plants in this experiment and the results were negative, in no plants have been detected the presence of the bacterium L. Ca asiaticus. No transmission results yet. We finished the second experiment that was performed to determine if the systemic insecticides are effective until 90 days after application and its effect on transmission of the bacteria. In this experiment, the time to reach 100% of mortality ranged from 3 to 7 days for both systemic insecticides tested (imidacloprid and thiamethoxam). The insecticides were effective up to 90 days after application. The results of PCR carried out for the ACP, in some periods, were positive for 100% of the samples, consisting of 10 insects tested, but in the confinement held at 46 days after application, in any sample was detected the presence of the bacteria. No acquisition in this period. In bioassays performed at 75 and 90 days after application, the percentage of positive samples was 50 to 70% and 10 to 40%, respectively. We started the experiment 2, and the difference from the experiment 1 is the application of varying doses of the systemic insecticides and confinement of the ACP in plants treated only 7 days after application. To thiamethoxam (Actara 250 WG), the doses tested were: 1, 0.5, 0.1 and 0.05 g/nursery tree and imidacloprid (Provado 200 SC) were: 1.75, 0.9, 0.2 and 0.08 mL/nursery tree. We also started the experiment 3, using different insecticide spraying to determine if they prevent the transmission and for how long. Using electrical penetration graphs (EPG) techniques, we are studying the probing behavior of ACP. In plants treated with insecticide, the proportion of insects reaching the phloem was similar among plants treated with imidacloprid (0.35 g AI/tree), thiamethoxam (0.25 g AI/tree) and control (untreated plants), being respectively 74, 72 and 76%. The time to perform the first ACP salivation was also similar among treatments, 118.4, 103.2, and 112.6 minutes, respectively. However, the time of phloem ingestion is drastically reduced compared to untreated plants: imidacloprid 6.1, 9.9 and 6.9 min, respectively for 15, 35 and 95 days after application (DAA); thiamethoxam 9.6, 14.5 and 17.5 min, respectively for 15, 35 and 95 DAA; Control 142.0, 80.3 and 129.0 minutes, respectively for 15, 35 and 95 DAA. Apparently, ACP can only distinguish among plants with and without treatment from the moment that started the ingesting of the phloem sap. In this case, it was observed that after the ingestion of sap with insecticide, the ACP removed the stylet from the plant and rarely returned to start a new probe on the same plant. In plants sprayed with mineral oil, decreased the percentage of psyllids that could reach the phloem when compared with plants not sprayed, 20 and 70% respectively. However, the few insects that reached the phloem of treated plants carried out long periods of ingestion in this vascular tissue (‘ 1 h).



Efficacy of seasonal insecticide programs for suppressing HLB in new citrus plantings

Project: Hall-91

Efficacy of seasonal insecticide programs for suppressing HLB in new citrus plantings

Project: Hall-91
Category: ACP Vector
Author: David Hall
Sponsor: Citrus Research and Development Foundation

USDA-ARS Experiment #1. Three potential psyllid management programs were investigated for protecting a new planting of citrus: (1) citrus subjected to an intensive insecticide program (annual chemical cost of $198/acre); (2) citrus interplanted with orange jasmine, with citrus subjected to a moderate insecticide program and jasmine not treated with insecticides (annual chemical cost of $156/acre); and (3) citrus interplanted with jasmine, with citrus subjected to a moderate insecticide program and jasmine regularly treated with insecticides (total annual chemical cost of $213/acre). Trees for the experiment were planted at the USDA-ARS citrus grove during May 2008 in east central Florida near Fort Pierce. Many trees at this grove were already infected by HLB when the new plantings were established, for research purposes most infected trees were not being removed, and also for research purposes much of the grove was only subjected to a minimal psyllid control program. The new citrus plantings for the experiment were therefore in the midst of high psyllid pressure and HLB inoculum. The trees were assayed for HLB quarterly, and trees testing RTPCR-positive for HLB (CT 30) were immediately removed. Numbers of psyllid captured on yellow sticky traps deployed in citrus trees indicated that relatively good psyllid control has been achieved under the intensive insecticide program. Under the reduced insecticide program for citrus interplanted with jasmine, relatively poor control of psyllids has been achieved in citrus whether jasmine was treated or not treated with pesticide (although psyllid levels in citrus were lower in plots where jasmine was treated). Numbers of psyllid on traps deployed in jasmine were frequently greater in plots where jasmine was not treated with insecticide. Lady beetles (species known to be predators of the psyllid) were relatively abundant in jasmine plants whether jasmine was treated or not treated with pesticide. Although less than 1% of the trees under each treatment tested positive for HLB 12 months after planting, during August 2010 (27 months after planting), the percentage of trees infected by HLB under treatments 1, 2 and 3 averaged 27, 33, and 30%, respectively. Based on these results, planting new citrus trees and getting them to a producing stage is difficult if HLB is endemic in the surrounding area and psyllids are not controlled across this area. USDA-ARS Experiment #2. Three ACP control programs are being compared for preventing HLB in a block of young, HLB-free citrus (Val on Carr): 1) citrus under a relaxed insecticide program (annual chemical cost of $173/acre); 2) citrus receiving monthly insecticide applications (annual chemical cost of $198/acre); and 3) citrus treated once every three weeks with spray oil [PureSpray Foliar (470, C27) and PureSpray Green (435, C23)] from February through November (plus a December application of Danitol) (annual chemical cost of $76/acre). There are two replications of each treatment. The experiment started in August 2009. In January 2010, 0%, 0.3% and 0.3% of the trees tested HLB positive under programs 1, 2 and 3, respectively. In July 2010, 25%, 7% and 10% of the trees tested positive under the three treatments. Infected trees are not removed in this experiment. UF Experiments – Updates on these experiments will be presented in the next quarterly report.



Development and Delivery of Comprehensive Management Plans for Asian Citrus Psyllid (ACP) Control in Florida Citrus

Project: 78266

Development and Delivery of Comprehensive Management Plans for Asian Citrus Psyllid (ACP) Control in Florida Citrus

Project: 78266
Category: ACP Vector
Author: Phillip Stansly
Sponsor: Citrus Research and Development Foundation

The response from growers to the extension program funded by this project has been excellent as demonstrated by wide adoption of practices we have developed and promoted such as area wide dormant sprays and ACP monitoring using tap samples For example, more than 70,000 acres were sprayed at least once by air and much of the rest by ground during cooperative dormant sprays in the SW Florida “Gulf” region. Application data were provided by the aerial applicators and survey data by Hendry County Cooperative Extension. Field ACP counts to evaluate the sprays were provided by growers and the FDOACS-DPI ACP sampling team trained under this project. Virtually all commercial groves in the region are participating in this program. As a result, the overall psyllid population in the area has steadily declined since the program was initiated in 2008. We are presently gearing up with Gulf Citrus Growers Association, FDOACS-DPI-CHRP, and Hendry County Cooperative Extension for the 2010-11 season with every expectation of another successful year . Detailed information about the success of this effort can be found in the upcoming (October 2010) issue of Citrus Industry Magazine. This practice has stimulated area wide management efforts in other citrus growing regions of the state and the present “CHMA” program of which we are a part. Another successful extension effort has been to encourage the adoption of the “stem tap” sample and other techniques for monitoring ACP populations. An extension (EDIS) document describing ACP sampling techniques (ENY857/IN867) is in-press. Our present management plan is based on four principles: (1) insecticidal sprays during winter targeting adult ACP to reduce the population reproducing in spring flush (2) the use of a rapid and reliable psyllid monitoring system to guide timing of insecticidal control during the growing season (3) conservation and augmentation of biological control agents (4) constant testing of insecticides in the lab and field, including techniques such as low-volume sprays and application timing. This grant has 5 objectives: (1) evaluate efficiency of potential ACP control techniques in cooperation with growers (2) develop efficient monitoring methods for ACP (3) accelerate testing of new chemistries and techniques for ACP management (4) evaluate the economic component of the comprehensive program and (5) provide an information bridge between researchers, growers, and industry. The experiments described below relate primarily to objectives 1, 3, and 5. (1) A large-scale (70-acre) timing trial involving a standard dormant spray (Mustang), compared to applications of aldicarb before and after spring flush with and without application of spirotetramat directly on the spring flush. All treatments successfully maintained populations lower than the control until May and treatments that included spirotetramat were effective until July. (2) A trial comparing low vs. high volume applications of spirotetramat was initiated on 9/30/10 (3) Bioassays and extensive field testing (5 trials) of systemic insecticides in a newly planted 5-acre block of “Hamlin” orange on 802 rootstock at our center. Materials tested include a new active ingredient, cyazypyr (cyantraniliprole) [DuPont, Wilmington, DE], which showed excellent promise in our preliminary lab bioassays as an important addition to an arsenal of soil-applied systemic insecticides. This is important as systemic options will be limited to the neonicotinoids imidacloprid and thiamethoxam with the loss of Temik next year. (4) Three more insecticide testing trials are currently under way. All our trial results are available to the public through grower presentations and our website, www,imok.ufl.edu/entlab. All results are published the year they are completed in the Entomological Society of America’s annual “Arthropod Management Tests” (www.entsoc.org). Six such reports on citrus pest management were published in 2009 alone.



Ultra low-volume and Aerial Application of Insecticides and Horticultural Mineral to Control Asian Citrus Psyllid in Commercial Orchards.

Project: 78150

Ultra low-volume and Aerial Application of Insecticides and Horticultural Mineral to Control Asian Citrus Psyllid in Commercial Orchards.

Project: 78150
Category: ACP Vector
Author: Phil Stansly
Sponsor: Citrus Research and Development Foundation

The main objective of this project was to evaluate the potential of both ground and aerial low volume (LV) insecticidal application to manage Asian citrus psyllid (ACP). We have been evaluating aerial and ground applications of various insecticidal products including horticultural mineral oils (HMO)at different times, concentrations, and conditions. During the last two years, thanks to this project, LV applications have become the norm during the dormant season in Southwest Florida. More than 73,000 acres in 48 groves were sprayed by air during the last area wide cooperative effort in the winter of 2010. In 2009, we compared a Proptec rotary spinning disk atomizer P-400D with a modified London Fogger 18-20 to determine which machine was more effective. We demonstrated that the Proptec was more effective in reducing an already low ACP population using frequent applications of undiluted 435 horticultural mineral oil (HMO) at 2 gallons per acre (GPA) applied every 2 to 4 weeks depending on ACP populations. An additional advantage of the Proptec is the ability to apply higher volumes to include nutrient mixes with the oil. Currently, we are conducting four new trials. In the first trial, we are using the Proptec to spray a mixture of micronutrients that has shown promise in previous experiments. The mixture has been modified to be sprayed every two weeks for 7 months at 10 GPA, which includes 2 gals of HMO within the mixture for ACP control. The trial was designed as a randomized complete block (RCB) with four replications in a 40-acre block of ‘pineapple’ oranges in Glades Co. that had not received a dormant spray and was expected to have high ACP populations. ACP was monitored on alternate weeks using the stem tap sampling. Contrary to expectations, ACP populations have been low, although the accumulated number of ACP is less in the treated plots (3.4′ 1.1 ACP x day) than in untreated plots (6.3’2.1 ACP x day). We are also tracking the development of the disease over time in response to the treatments. An earlier sample analyzed by the PCR laboratory at the Southwest Florida Research and Education Center (SWFREC) indicated an initial HLB infection rate in the block of 11%. Recent samples have been submitted for PCR analysis to test for treatment effects. In a second trial employing an RCB design with three replicates, we are evaluating the effects of frequent (every two weeks) of 2% (v/v) HMO sprayed at 100 GPA with an airblast sprayer in an 85-acre block of organic ‘Valencia’ oranges in Charlotte Co. However, applications have not produced observable differences between the treated and the untreated plots, although ACP populations have been extremely low. A third trial is evaluating coverage, deposition, and absorption is underway in a 16-acre block of ‘Valencia’ oranges in Collier Co. Applications of a micronutrient package using the Proptec sprayer @ 10 GPA every two weeks are being compared to an air blast sprayer applying 100 GPA three times a year during the summer, fall, and spring flush. Both treatments used the same overall amount of active ingredient. Leaf samples have been collected and are being analyzed for absorption of the micronutrients at the Foliar Analysis Laboratory at the University of Florida’s Everglades Research and Education Center. In a fourth trial we are evaluating effects of spray volume on activity of spirotetramat + 2% oil applied at 10 oz/ac. We are comparing 5, 10, 40 and 120 GPA of total solution to evaluate the efficacy of this product at low and high volumes of application. The two lower volume rates are being applied with the Proptec by varying pump speed and the two higher rates are being applied with a speed sprayer by changing nozzle types. After two weeks, first indications show no significant differences among volumes.



An effective trap for Asian citrus psyllid that can be used to monitor groves and plants for sale

Project: NFREC-Quincy, University of Florida

An effective trap for Asian citrus psyllid that can be used to monitor groves and plants for sale

Project: NFREC-Quincy, University of Florida
Category: ACP Vector
Author: Russell Mizell
Sponsor: Citrus Research and Development Foundation

We have just recently received notice of awarding of funds and that the subcontracts are in place. We have initiated further behavioral studies in the laboratory to better understand psyllid responses to traps. We also are developing prototype traps components using an autocad program so that we can enable private companies to construct the traps for field testing.



An effective trap for Asian citrus psyllid that can be used to monitor groves and plants for sale

Project: NFREC-Quincy, University of Florida

An effective trap for Asian citrus psyllid that can be used to monitor groves and plants for sale

Project: NFREC-Quincy, University of Florida
Category: ACP Vector
Author: Russell Mizell
Sponsor: Citrus Research and Development Foundation

We received notice of the awarding of subcontract funds and that the subcontracts were in place on April 29, 2011. We have initiated further behavioral studies in the laboratory to better understand psyllid responses to traps. We also are developing prototype traps components using an autocad program so that we can enable private companies to construct the prototype traps for field testing. Following the long period of down time with the subcontracts we were unable to maintain viable colonies of psyllids with which to work. To date the lab colonies have been restored and we are seeking a lab technician to continue more intensive lab bioassays. Do to the lost time we will need another year to complete the project.



Controlling HLB by controlling psyllids with RNA interference

Project: NAS ID 122

Controlling HLB by controlling psyllids with RNA interference

Project: NAS ID 122
Category: ACP Vector
Author: Bryce Falk
Sponsor: Citrus Research and Development Foundation

The potato/tomato psyllid, Bactericerca cockerelli (B. cockerelli), is a very important plant pest and also vectors of phloem-limited bacterium Candidatus Liberibacter psyllaurous (solanacearum), which is associated with zebra chip disease of potatoes. The B. cockerelli – Ca. L. solanacearum interaction very much resembles that of the Asian citrus psyllid, Diaphorina citri and Ca. L. asiaticus ‘ the latter being the causal agent of HLB. Because the B. cockerelli – Ca. L. solanacearum complex is associated with herbaceous as opposed to woody plants for HLB, we used it as a more facile and simple model system to assess RNA interference potential as a potential strategy for assessing RNAi effects in psyllids. We generated specific dsRNAs and siRNAs in vitro, and expressed anti-psyllid sequences in plants by using plant-infecting RNA viruses. We were able to detect molecular hallmarks of RNAi activity in psyllids, including mRNA reduction and generation of specific siRNAs. We also observed mortality in psyllids after feeding on artificial diets containing specific effector RNAs, and after feeding on plants infected with recombinant plant viruses. We are further testing additional sequences and transgenic plants for inducing RNAi effects in B. cockerelli with hope to apply this towards the Asian citrus psyllid.



Optimization of water and nitrate application efficiency for Citrus trees: recommendations for irrigation and fertigation practices

Project: 5100-150   Year: 2014

Optimization of water and nitrate application efficiency for Citrus trees: recommendations for irrigation and fertigation practices

Project: 5100-150   Year: 2014
Category: ACP Vector
Author: Barzin Ahmad Moradi
Sponsor: California Citrus Research Board

Progress made so far: 1. Soil Survey: soil heterogeneities across the field as well as with soil depth (layering) have been quantified in both study sites (oranges orchard, Orange Cove, CA, and mandarin site, Strathmore, CA) through an extensive soil survey. Soil core samples were taken from depth 0-300 cm in 8 location across each orchard and were characterized. This task was completed 2. Root zone monitoring: 6 sets of soil moisture and soil water potential sensors were installed in 6 locations, each location in 5 different depths, in the root zone of the trees in both oranges and mandarin orchards. They are recording data on soil water status following irrigation, rainfall, and root water uptake. Installation was completed and data collection will continue throughout the project. 3. Deep soil monitoring: 12 sets of soil water potential sensors and nitrate samplers were installed at 230 and 260 cm deep in 12 locations across the field in each orchard for monitoring leaching of water and nitrate across the field. Installation was completed and data collection will continue throughout the project. 4. We evaluated the performance of soil moisture sensors (water capacitance sensors) against actual measurements of soil suction and water availability for tree roots and made suggestion on how to best use the data from these sensors depending on the soil type. Our results and our recommendations were demonstrated to a group of growers on site. Plan for the remainders of the year: 1. Data collection on water and nitrate from root zone as well as below the root zone of trees from all locations that are being monitored. 2. Root distribution of selected trees will be investigated in both orchards. This data will reveal where in soil profile the roots are taking up water and nutrients. 3. All the collected data on water and nitrate and root study data will be used to build up and calibrate models of water and nutrients movement in every orchard. This will allow scenario analysis for recommendations on irrigation and fertigation practices. B. Ahmad Moradi 106 Veihmeyer hall Department of Land, Air and Water Resources University of California Davis 1 Shields Ave. Davis CA 95616 Phone (530)752-1210 Fax (530)752-0256 email: amoradi@ucdavis.edu



Phloem specific responses to CLas for the identification of novel HLB resistance genes

Project: 18-019   Year: 2019

Phloem specific responses to CLas for the identification of novel HLB resistance genes

Project: 18-019   Year: 2019
Category: ACP Vector
Author: Elizabeth Rogers
Sponsor: Citrus Research and Development Foundation

Our project is examining phloem gene expression changes in response to CLas infection in HLB-susceptible sweet orange and HLB-resistant Poncirus and Carrizo (a sweet orange – Poncirus cross). We are using a recently developed methodology for woody crops that allows gene expression profiling of phloem tissues. The method leverages a translating ribosome affinity purification strategy (called TRAP) to isolate and characterize translating mRNAs from phloem specific tissues. Our approach is unlike other gene expression profiling methods in that it only samples gene transcripts that are actively being transcribed into proteins and is thus a better representation of active cellular processes than total cellular mRNA. Sweet orange, and HLB-resistant Poncirus and Carrizo (sweet orange x Poncirus) will be transformed to express the tagged ribosomal proteins under the control of characterized phloem-specific promoters; tagged ribosomal proteins under control of the nearly ubiquitous CaMV 35S promoter will be used as a control. Transgenic plants will be exposed to CLas+ or CLas- ACP and leaves sampled 1, 2, 4, 8, and 12 weeks later. Ribosome-associated mRNA will be sequenced and analyzed to identify differentially regulated genes at each time point and between each citrus cultivar. Comparisons of susceptible and resistant phloem cell responses to CLas will identify those genes that are differentially regulated during these host responses. Identified genes will represent unique phloem specific targets for CRISPR knockout or overexpression, permitting the generation of HLB-resistant variants of major citrus cultivars.
This is the first year, 3nd quarter progress report; our grant started December 1, 2018. In the last three months, the post-doctoral researcher, Tami Collum, has started optimizing nucleic acid extraction protocols for citrus. For objective 6 (Additional Approach: Phloem limited citrus tristeza virus vectors will be used to express the His-FLAG-tagged ribosomal protein in healthy and CLas infected citrus) Dr. Dawson’s lab has all necessary constructs and has moved many of them into citrus. CTV-infected plants will soon be ready for shipment to Maryland. Again, the majority of our efforts in the 3nd quarter were focused on objective 2 (production of transgenic citrus lines). The Stover lab has performed Agrobacterium-mediated transformation of seedling epicotyls from all three citrus genotypes indicated in the grant (Carrizo, Poncirus and Hamlin sweet orange) with the His-FLAG tagged RPL18 (ribosomal protein L18) under the 35S promoter and all three phloem promoters pSUC2, pSUL and p396ss. Carrizo transgenic plants with three promoters are already acclimatized in the greenhouse: p35S::HF-RPL18 (12 plants), pSUL::HF-RPL18 (21 plants), and p396ss::HF-RPL18 (30 plants), with many plants >25 cm and suitable for taking cuttings for replication. Seven plants transformed with each promoter were evaluated for presence (PCR) and expression (RT-qPCR) of the HF-RPL18 gene, and 100% of the plants are expressing the gene. The newly transformed Carrizo with the pSUC2 promoter has been transferred to greenhouse and will be evaluated soon. Putative transgenic plants of Poncirus harboring the 35S::HF-RPL18 (12 plants) and pSUL::HF-RPL18 (10 plants) were moved to the soil. Poncirus plants with constructions p396ss::HF-RPL18 and pSUC2::HF-RPL18 are still in rooting medium (16 and 49 plantlets, respectively). Hamlin transformation was intensified in this quarter and many shoots have being transferred to rooting media, and one plant to soil. Since Hamlin has a much lower transformation efficiency, some transformations were repeated and also cotyledons have being used as a new transformation target explant for this genotype. Carrizo plants expressing the HF-RPL18 gene will be replicated and transferred to Ft. Detrick in the next quarter.